DA425916

From Wikicell

Jump to: navigation, search

Image:Normal Image.jpg


IDENTIFIERS

dbEST Id:       33213497
EST name:       DA425916
GenBank Acc:    DA425916
GenBank gi:     80757260

CLONE INFO
Clone Id:       COLON2001039 (5')
DNA type:       cDNA

PRIMERS
PolyA Tail:     Unknown

SEQUENCE
                GCTTGCTGCGCGCTGCCGGCGCTCCTTCCTCCTCGGCTCGCGTCTCACTCAGTGTACCTT
                CTAGTCCCGCCATGGCCGCTCTCACCCGGGACCCCCAGTTCCAGAAGCTGCAGCAATGGT
                ACCGCGAGCACCGCTCCGAGCTGAACCTGCGCCGCCTCTTCGATGCCAACAAGGACCGCT
                TCAACCACTTCAGCTTGACCCTCAACACCAACCATGGGCATATCCTGGTGGATTACTCCA
                AGAACCTGGTGACGGAGGACGTGATGCGGATGCTGGTGGACTTGGCCAAGTCCAGGGGCG
                TGGAGGCCGCCCGGGAGCGGATGTTCAATGGTGAGAAGATCAACTACACCGAGGGTCGAG
                CCGTGCTGCACGTGGCTCTGCGGAACCGGTCAAACACACCCATCCTGGTAGACGGCAAGG
                ATGTGATGCCAGAGGTCAACAAGGTTCTGGACAAGATGAAGTCTTTCTGCCA

Entry Created:  Nov 5 2005
Last Updated:   Jan 16 2008

COMMENTS
                NEDO human cDNA project (New Energy and Industrial
                Technology Developmental Organization, Japan); cDNA library
                construction: Helix Research Institute (HRI); 5'-end one
                pass sequencing: HRI, Research Association for Biotechnology
                (RAB) and Biotechnology Center, National Institute of
                Technology and Evaluation; 3'-end one pass sequencing: RAB.

LIBRARY
dbEST lib id:   18350
Lib Name:       COLON2
Organism:       Homo sapiens
Tissue type:    colon
Vector:         pME18SFL3

SUBMITTER
Name:           Takao Isogai
Lab:            FLJ Project (HRI Team)
Institution:    Helix Research Institute
Address:        2-6-7 Kazusa-Kamatari, Kisarazu, Chiba, 292-0818, Japan
E-mail:         flj-cdna@nifty.com

CITATIONS
PubMed ID:      16344560
Title:          Diversification of Transcriptional Modulation: Large-scale
                Identification and Characterization of Putative Alternative
                Promoters of Human Genes
Authors:        Kimura,K., Wakamatsu,A., Suzuki,Y., Ota,T., Nishikawa,T.,
                Yamashita,R., Yamamoto,J., Sekine,M., Tsuritani,K.,
                Wakaguri,H., Ishii,S., Sugiyama,T., Saito,K., Isono,Y.,
                Irie,R., Kushida,N., Yoneyama,T., Otsuka,R., Kanda,K.,
                Yokoi,T., Kondo,H., Wagatsuma,M., Murakawa,K., Ishida,S.,
                Ishibashi,T., Takahashi-Fujii,A., Tanase,T., Nagai,K.,
                Kikuchi,H., Nakai,K., Isogai,T., Sugano,S.
Citation:       Genome Res. 16 (1): 55-65 2006


MAP DATA




Sequence Feature

qName matches misMatches repMatches nCount qNumInsert qBaseInsert tNumInsert tBaseInsert strand qSize qStart qEnd tName tSize tStart tEnd
DA425916 472 0 0 0 0 0 3 3034 + 472 0 472 chr19 63811651 39547940 39551446



Block Feature

qName blockCount blockSizes qStarts tStarts
DA425916 4 193,91,69,119, 0,193,284,353, 39547940,39549089,39549527,39551327,





Path:Human-->Digestive System-->Digestive Tract-->Large Intestine-->Colon-->DA425916

Personal tools